EST details — SGN-E398076

Search information 
Request: 398076Match: SGN-E398076
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183435Clone name: TUS-42-C17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183435 is on microarray TOM1 spot ID 1-1-8.3.1.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14357 [cLEC-7-K23] Trace: SGN-T25395 EST: SGN-E202113 Direction: 5' Facility: TIGR
Clone: SGN-C183435 [TUS-42-C17] Trace: SGN-T1759 EST: SGN-E378312 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183435 [TUS-42-C17] Trace: SGN-T194918 EST: SGN-E393592 Direction: 5' Facility: INRA
Clone: SGN-C183435 [TUS-42-C17] Trace: SGN-T195477 EST: SGN-E394151 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398076Length: 451 bp (851 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398076 [] (trimmed) CTACAGTTGAGGACAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACT
AAAGTACCTCAAATATTCCTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCAA
TGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCGGAAAAATGGGGTTTTTTCCAAGTGGTTAATCATGGGATTCCAA
CATCCGTCTTGGACACAACGTTGCAAGGAACACGACAGTTCTTTGACCAACATAAAAACCTGCAAGTTGGAGAGACACAATTTTCTGTTACATGG
CTCCGAATCCCCCCAGTCTACAAGAATTTCCCACTCCATGCCGGGAGTTCATTAATACACTTCTCCAAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398076] SGN-U577519 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199402 [Download][View] Facility Assigned ID: FA0AAD30AB09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0166 Quality Trim Threshold: 14.5