EST details — SGN-E398132
| Search information |
| Request: 398132 | Match: SGN-E398132 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183100 | Clone name: TUS-41-E18 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183100 is on microarray TOM1 spot ID 1-1-7.1.3.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C48204 [cLEI-3-L6] | Trace: SGN-T80145 | EST: SGN-E266457 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183100 [TUS-41-E18] | Trace: SGN-T196498 | EST: SGN-E395172 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E398132 | Length: 138 bp (940 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E398132 [] (trimmed)
ATAAAAACTTGTTGATGTATATTGTAAAAAAAAAAAAACAGCTGCGGGCTGCATGATTTTGCAGCCACTTCAACCTTTCTCTCCATTTAACCATA
CTTAGGTTAAAAGGTTGATACACACTCAAAAATATCGAAAAAT
CTTAGGTTAAAAGGTTGATACACACTCAAAAATATCGAAAAAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398132] | SGN-U578473 | Tomato 200607 | Build 2 | 46 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199458 [Download][View] | Facility Assigned ID: FA0AAD29BC09FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.864 | Expected Error Rate: 0.0189 | Quality Trim Threshold: 14.5 |
Working
