Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E398138

Search information 
Request: 398138Match: SGN-E398138
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183150Clone name: TUS-41-G20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183150 is on microarray TOM1 spot ID 1-1-5.3.3.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67177 [cLEN-17-L2] Trace: SGN-T91034 EST: SGN-E276613 Direction: 5' Facility: TIGR
Clone: SGN-C183150 [TUS-41-G20] Trace: SGN-T196505 EST: SGN-E395179 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398138Length: 353 bp (898 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398138 [] (trimmed) AATAGATGGTAAAACATCATTATTGGAATTTTTATTTTAGCAAATAACATTGTCTTATTTAGGAACATTGTTATTTCACCACACATTACGACAAA
CAACCAGAATAAAACGTACGTAAACTTTACTCCTATCTTTACGGGAGTTTCATCACACATTACATTTACATAAATAACATACATACATACATAGA
ATTAAATAGGATTACATTAATTAATCCTCTTGCAATCTTTCCTAATCTCTCCATTAGTACCTGTTAATGGACTAATATTTCCCAATTTAATCATT
GAACAAACAAAATCATCAAAGAACTTGGGTTGATTATTTGCATAATTAGTCACAATTGAAATTGTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398138] SGN-U590731 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199464 [Download][View] Facility Assigned ID: FA0AAD29BD10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.894 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5