EST details — SGN-E398161

Search information 
Request: 398161Match: SGN-E398161
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183298Clone name: TUS-41-M24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183298 is on microarray TOM1 spot ID 1-1-1.1.3.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C62337 [cLEM-21-E12] Trace: SGN-T86700 EST: SGN-E272702 Direction: 5' Facility: TIGR
Clone: SGN-C183298 [TUS-41-M24] Trace: SGN-T199736 EST: SGN-E398410 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398161Length: 293 bp (882 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398161 [] (trimmed) ACTCGAAAATATCGAACCCTTTAAAAAAGTTACCAAAAGTATGGTTAGGGGTAAATTTTCGACCTAAACAAAGTTTTCCACTAATGTAAACCACA
TGGATGACAAAACCACGATCCTTACAACCCCTCAAACACCCTTCTAAAGCCCTATGTTGTGAATATAACATGACAATATCACCATACATGACGTT
GCAAGTATAAATATCTATGCTTGCAGAACAAAAACGGGGAAACTCCCATGAATGTGTCACTCCGTCTTCTTAACAAATTCATCAATGGCACCCAA
TCTTTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398161] SGN-U578791 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199487 [Download][View] Facility Assigned ID: FA0AAD29BG12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5