EST details — SGN-E398162

Search information 
Request: 398162Match: SGN-E398162
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183326Clone name: TUS-41-O4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183326 is on microarray TOM1 spot ID 1-1-5.3.3.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183326 [TUS-41-O4] Trace: SGN-T196524 EST: SGN-E395198 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398162Length: 123 bp (947 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398162 [] (trimmed) GCATCTACAATATATTTGCATTTCTGAAGATTTCAGTTACACAAATGGTAGTACTTCCAATGAATTGAAACATAAATCTAAGCTCCAGGAACAAA
CTTAGTGGCGTAAACCCAAGCATTGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398162] SGN-U577678 Tomato 200607 Build 2 148 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199488 [Download][View] Facility Assigned ID: FA0AAD29BH02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.898 Expected Error Rate: 0.0124 Quality Trim Threshold: 14.5