EST details — SGN-E398169

Search information 
Request: 398169Match: SGN-E398169
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183011Clone name: TUS-41-B1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183011 is on microarray TOM1 spot ID 1-1-8.2.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67156 [cLEN-17-K2] Trace: SGN-T90816 EST: SGN-E276395 Direction: 5' Facility: TIGR
Clone: SGN-C183011 [TUS-41-B1] Trace: SGN-T195161 EST: SGN-E393835 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398169Length: 419 bp (864 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398169 [] (trimmed) CAGCTTCATTTATGATTGTCTACTTATCACGGACTGACAGGTTGTCCAACTAATGATGGTTGACAGCAAGCGTGCTATACCTTTGTTGATCCAGC
ATAGGGACTTTATATATCCACCCGAAGTGGTGTCACAACTTATGGCTGCAAAGACTAAGTGTGATTGTCGGTACCTTTTGCATTTGTATCTTCAT
TCACTATTTGAAGTGAATCCTCATGCTGGACGGGATTACCATGACATGCAGGTTTATATACAATCACCCTGGGATCTTTCACTTTAAAGTTTATC
TTGTGGTAATTTGTCGGTGAGGTCTATGTGGCATGTCAATGCATCTTCTATGACGAGAAATTAAGAATTGTTGAATTGTAATTGAAGGTCCAGCT
TTATGCTGACTATAATCCAAAAAATGATGCTTTCCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398169] SGN-U585165 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199495 [Download][View] Facility Assigned ID: FA0AAD29CA01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0202 Quality Trim Threshold: 14.5