EST details — SGN-E398251

Search information 
Request: 398251Match: SGN-E398251
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183558Clone name: TUS-42-H20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183558 is on microarray TOM1 spot ID 1-1-5.4.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183558 [TUS-42-H20] Trace: SGN-T195984 EST: SGN-E394658 Direction: 3' Facility: INRA
Clone: SGN-C183558 [TUS-42-H20] Trace: SGN-T195984 EST: SGN-E399469 Direction: 3' Facility: INRA
Clone: SGN-C183558 [TUS-42-H20] Trace: SGN-T195985 EST: SGN-E394659 Direction: 5' Facility: INRA
Clone: SGN-C183558 [TUS-42-H20] Trace: SGN-T200414 EST: SGN-E399470 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398251Length: 298 bp (867 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398251 [] (trimmed) AACAATATATGAAAATCTTCAGTCTTTAATGAATTCAAGATGTAAGGGAATGAAATATTTATAGAAGTTGGTACATTATTATTATTATTATTACA
ATAATCACAAGTATACAGAAATTAGCAGGCAATTGACCTTTGAATCAAAACAATTGACTCCAAACTAAACTACAGAACTCCAAGAAAAGCAGAGG
TTTCCCTTCTTCATCTTTTATTTGGACAGGAGAAAATAGTGAAAAATCAACACAGAGTCCATCACAACCTTCTTCCTGATACCGCGTTCCTTCAT
TTTCACCTGCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398251] SGN-U577579 Tomato 200607 Build 2 90 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199577 [Download][View] Facility Assigned ID: FA0AAD30DD10FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0042 Quality Trim Threshold: 12.5