EST details — SGN-E398259

Search information 
Request: 398259Match: SGN-E398259
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172825Clone name: TUS-14-I15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172825 is on microarray TOM1 spot ID 1-1-2.1.20.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11006 [cLEC-6-O12] Trace: SGN-T23978 EST: SGN-E202317 Direction: 5' Facility: TIGR
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195127 EST: SGN-E393801 Direction: 3' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195313 EST: SGN-E393987 Direction: 5' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195750 EST: SGN-E394424 Direction: 3' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T195750 EST: SGN-E398948 Direction: 3' Facility: INRA
Clone: SGN-C172825 [TUS-14-I15] Trace: SGN-T199585 EST: SGN-E398949 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398259Length: 164 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398259 [] (trimmed) GATACCCATTTTAATATATATATATATATATAATACATGATGTAGTCCCTTTAAAAGTTACCACATATTGAAGTAGTAGTATGTACAAAATTAAG
AAATTGCTCTGTTTTCATATATTGTTCTTAATCACAAACAATCACGCAACTATGTTTGTTTGTGTTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398259] SGN-U565601 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199585 [Download][View] Facility Assigned ID: FA0AAD2AE08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.836 Expected Error Rate: 0.0284 Quality Trim Threshold: 14.5