EST details — SGN-E398259
| Search information |
| Request: 398259 | Match: SGN-E398259 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C172825 | Clone name: TUS-14-I15 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172825 is on microarray TOM1 spot ID 1-1-2.1.20.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C11006 [cLEC-6-O12] | Trace: SGN-T23978 | EST: SGN-E202317 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C172825 [TUS-14-I15] | Trace: SGN-T195127 | EST: SGN-E393801 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172825 [TUS-14-I15] | Trace: SGN-T195313 | EST: SGN-E393987 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172825 [TUS-14-I15] | Trace: SGN-T195750 | EST: SGN-E394424 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172825 [TUS-14-I15] | Trace: SGN-T195750 | EST: SGN-E398948 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172825 [TUS-14-I15] | Trace: SGN-T199585 | EST: SGN-E398949 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E398259 | Length: 164 bp (933 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E398259 [] (trimmed)
GATACCCATTTTAATATATATATATATATATAATACATGATGTAGTCCCTTTAAAAGTTACCACATATTGAAGTAGTAGTATGTACAAAATTAAG
AAATTGCTCTGTTTTCATATATTGTTCTTAATCACAAACAATCACGCAACTATGTTTGTTTGTGTTGTT
AAATTGCTCTGTTTTCATATATTGTTCTTAATCACAAACAATCACGCAACTATGTTTGTTTGTGTTGTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398259] | SGN-U565601 | Tomato 200607 | Build 2 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199585 [Download][View] | Facility Assigned ID: FA0AAD2AE08RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.836 | Expected Error Rate: 0.0284 | Quality Trim Threshold: 14.5 |


