EST details — SGN-E398273

Search information 
Request: 398273Match: SGN-E398273
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172764Clone name: TUS-14-G2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172764 is on microarray TOM1 spot ID 1-1-7.3.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10910 [cLEC-6-J7] Trace: SGN-T24179 EST: SGN-E202518 Direction: 5' Facility: TIGR
Clone: SGN-C172764 [TUS-14-G2] Trace: SGN-T195229 EST: SGN-E393903 Direction: 3' Facility: INRA
Clone: SGN-C172764 [TUS-14-G2] Trace: SGN-T195376 EST: SGN-E394050 Direction: 5' Facility: INRA
Clone: SGN-C172764 [TUS-14-G2] Trace: SGN-T195671 EST: SGN-E394345 Direction: 3' Facility: INRA
Clone: SGN-C172764 [TUS-14-G2] Trace: SGN-T195671 EST: SGN-E399051 Direction: 3' Facility: INRA
Clone: SGN-C172764 [TUS-14-G2] Trace: SGN-T199599 EST: SGN-E399052 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398273Length: 385 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398273 [] (trimmed) AGGACACCTTTAAATCCATTCACTAGAAAACTCATTATTTATTACCCCCCTTAAAAAAGCAACATTTTACAAGGTAATTCAACAGAAGATTGCGA
GGAAAGTCCAAAACACACATGATCATTTTGGAAATCACAATACATCCTTCTTTACATCACACGAGATTGGTAAAATATATTTTGACTTTTGCTCT
TTTTTTTTAACTCGATCCATTTATAATATCACACTAAATTTATTGTTATTATGCACGATATATGATAAGATGACACAACACTTATACCAAATATG
GAAATTCCACGAATATTAAAAATGTAACTAAAATAACAATTTAGAAGAGATGGTGGTGTTTTTTCTCAGCTTTTTTTTCTTCTTTCTTGGCATCT
TTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398273] SGN-U581076 Tomato 200607 Build 2 416 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199599 [Download][View] Facility Assigned ID: FA0AAD2BD01RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5