EST details — SGN-E398293

Search information 
Request: 398293Match: SGN-E398293
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172968Clone name: TUS-14-O14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172968 is on microarray TOM1 spot ID 1-1-3.3.20.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14385 [cLEC-7-L8] Trace: SGN-T25502 EST: SGN-E202220 Direction: 5' Facility: TIGR
Clone: SGN-C172968 [TUS-14-O14] Trace: SGN-T1266 EST: SGN-E378242 Direction: 5' Facility: Giov. Lab
Clone: SGN-C172968 [TUS-14-O14] Trace: SGN-T195261 EST: SGN-E393935 Direction: 3' Facility: INRA
Clone: SGN-C172968 [TUS-14-O14] Trace: SGN-T195262 EST: SGN-E393936 Direction: 5' Facility: INRA
Clone: SGN-C172968 [TUS-14-O14] Trace: SGN-T195411 EST: SGN-E394085 Direction: 5' Facility: INRA
Clone: SGN-C172968 [TUS-14-O14] Trace: SGN-T199619 EST: SGN-E399105 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398293Length: 620 bp (851 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398293 [] (trimmed) AACAAAACTTTGGATCTCCAGCTGCACCAGTTCAGGAACGACCAATTCAGAGATCATGGGTTCCTCCCCAGCCTCCTCCAGTCGCAATGGCAGAG
GCAGCTGCAGCCATCCGCCAACCTAAAAAGTCTGCATCTCAGAACGAACAGTTGACTGATGATCAGTTGTTAGCTCGTTCATCAGATGAGTTGCA
GAGGGTTACAAGAATCTCCGAATCTGGTGGTGCCCCTGAAGCTAATGGTTCGAGTTCTGGCCTACAGATGAGTGAAACAACACCAATTGAAGAAG
GTGATCAAACTTTCAGCAGCTGAAATATCATTTAATTTCCTTGATATAAAACGCTGGGCATTCACTATTGAGGTTCATCACGATCTTACAGCTAC
ACGTTCTTGATAAATCGAGCCTCATTTCGTGTTTACCCCCAAGTTACATTTATCAACTTTTTGGTATATGGTTGTCTATTCATTACACACTCTAA
ACTGGCTGCAGACTTAAGAATTGTATTTATATAATTCTACAGTTTGAATAAAGGTTAGATTATGTGAATAACATAATTCATGTTCAGTAATTTGG
TGGATACAAAAAGTATTCTAATAAATCAAAGTGTGGCCCTATTGTTCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398293] SGN-U575659 Tomato 200607 Build 2 56 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199619 [Download][View] Facility Assigned ID: FA0AAD2BH07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0084 Quality Trim Threshold: 12.5