EST details — SGN-E398327

Search information 
Request: 398327Match: SGN-E398327
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183438Clone name: TUS-42-C20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183438 is on microarray TOM1 spot ID 1-1-5.3.1.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C110306 [cLPT-4-E6] Trace: SGN-T178218 EST: SGN-E364817 Direction: 5' Facility: TIGR
Clone: SGN-C183438 [TUS-42-C20] Trace: SGN-T1760 EST: SGN-E378617 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183438 [TUS-42-C20] Trace: SGN-T195016 EST: SGN-E393690 Direction: 5' Facility: INRA
Clone: SGN-C183438 [TUS-42-C20] Trace: SGN-T196011 EST: SGN-E394685 Direction: 3' Facility: INRA
Clone: SGN-C183438 [TUS-42-C20] Trace: SGN-T199653 EST: SGN-E399234 Direction: 5' Facility: INRA
Clone: SGN-C183438 [TUS-42-C20] Trace: SGN-T200280 EST: SGN-E399233 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398327Length: 376 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398327 [] (trimmed) ATATTAAAACAAAGTACTCCATATATATATATATATATATATATATATATATATATATATAGTTAAAATACGTGCACCAAACATTATAAGGTAAA
TCCAAGATTTAGAAAAGCATAAACAACAGCACAAGAGCGCGAACACTAATACTATTACAATTGCATGCTAAGGCACGCAACTTATTATTATTATC
ATCATATGTACTCTCTAATCTCTATTACTACTATTACTACTACTACACCCAAAAGCTAATTAATAAACTACTCAGCCATAAAATACTCCCGAAAT
AACACTTTGATCCTGTTCAGTAAAATTGATGATGAGGGGAAGCAAAGTCCTCCTTCTTATAAACATTATGAGGATCATATGCGACAATCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398327] SGN-U578439 Tomato 200607 Build 2 74 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199653 [Download][View] Facility Assigned ID: FA0AAD30BB10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.864 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5