EST details — SGN-E398331
| Search information |
| Request: 398331 | Match: SGN-E398331 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183582 | Clone name: TUS-42-I20 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183582 is on microarray TOM1 spot ID 1-1-5.1.1.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C71873 [cLER-19-G19] | Trace: SGN-T96392 | EST: SGN-E284820 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183582 [TUS-42-I20] | Trace: SGN-T195041 | EST: SGN-E393715 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183582 [TUS-42-I20] | Trace: SGN-T200309 | EST: SGN-E399281 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E398331 | Length: 206 bp (856 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E398331 [] (trimmed)
CCGACGCAAAACAATCAGCGACCAAACAAGTAGCTGAGCAGAGAGATGGCTGCTCCGGCTGCCGAGGGTCTGGCTGTGACGGCGCTGCGGTCGGT
GCTCCACCGTGTCCGTCAGGCTGCTGAAAGGTCCGGTCGCCGTGCTGATGACGTGAGAGTGTTGGCCGTTAGCAAGACGAAGCCTATTTCTCTTA
TTACCCAAGTGTATGA
GCTCCACCGTGTCCGTCAGGCTGCTGAAAGGTCCGGTCGCCGTGCTGATGACGTGAGAGTGTTGGCCGTTAGCAAGACGAAGCCTATTTCTCTTA
TTACCCAAGTGTATGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398331] | SGN-U565389 | Tomato 200607 | Build 2 | 40 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199657 [Download][View] | Facility Assigned ID: FA0AAD30BE10RM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.979 | Expected Error Rate: 0.0061 | Quality Trim Threshold: 14.5 |
Working
