EST details — SGN-E398351
| Search information |
| Request: 398351 | Match: SGN-E398351 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183590 | Clone name: TUS-42-J4 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183590 is on microarray TOM1 spot ID 1-1-5.2.2.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C183590 [TUS-42-J4] | Trace: SGN-T195535 | EST: SGN-E394209 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183590 [TUS-42-J4] | Trace: SGN-T199677 | EST: SGN-E399473 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E398351 | Length: 107 bp (859 bp untrimmed) |
| Status: Current Version | Direction: 3' |
>SGN-E398351 [] (trimmed)
CGACAACTCGTCTCAAGTTTGTTATTTTTTTGTTTTTAATGGTTTGTGCTGTCACATTCTTATTTGTGCGATTTTACACAAAATATTAAAGATAC
CCTTACAGGTGC
CCTTACAGGTGC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398351] | SGN-U598079 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199677 [Download][View] | Facility Assigned ID: FA0AAD30DE02FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.939 | Expected Error Rate: 0.0432 | Quality Trim Threshold: 14.5 |


