EST details — SGN-E398534

Search information 
Request: 398534Match: SGN-E398534
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174439Clone name: TUS-18-L21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174439 is on microarray TOM1 spot ID 1-1-4.4.15.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23048 [cLED-4-F23] Trace: SGN-T49294 EST: SGN-E231525 Direction: 5' Facility: TIGR
Clone: SGN-C174439 [TUS-18-L21] Trace: SGN-T197278 EST: SGN-E395952 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398534Length: 388 bp (854 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398534 [] (trimmed) CCCTTTTTAGAGCACGAGCCTGGGCGAATCTAGTTTAGGTACTTTTTTTATAACTTGATTTGATTGTACAACAAGAATTTTGTTTGCTCGCACTA
CGAGCGAGGAATTGGAGATTTTTGAGACATGATATTTAAGCTAATAACATTTTCATCGTACTCCCCATTTGAGGAGTTAAGTCGTAGGTTGTTCC
TCTTCCATTGTGCTTGTTCTTCATGACTCCATTTTTATTAACATTGTTGTAAGCATCCATAAACATCTGAATCCTTGCAAGTGCGATCTCCATTG
TTTGATCATCGATATTTGCAAAACAAACTCGAAACCATCCTACCTCCGAGCTATTGAACGAAGATCCAGGGGAGACGTTGAGCTTAACTTCGATT
ATGATGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398534] SGN-U583839 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199860 [Download][View] Facility Assigned ID: FA0AAD6CF11FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0163 Quality Trim Threshold: 14.5