EST details — SGN-E398554
| Search information |
| Request: 398554 | Match: SGN-E398554 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C174543 | Clone name: TUS-19-A5 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C174543 is on microarray TOM1 spot ID 1-1-4.1.15.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E398554 | Length: 218 bp (930 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E398554 [] (trimmed)
CAGATTGCATCTACGTTCAAAGGAGCAATCGATGACCTGGATGTTATTCTTGAAACACTCAAAGAGGGTGGCTATTCACAACATAGGTTTTACAT
CCATTGTGATGCAGCACTATGTGGTCTTATGACCCCTTTTATAAACAATATGATTAGTTTCAAGAAGCCAATTGGAACTGTCACAATTTCTGGTC
ACAAGTTCTTACGATGCCCAGATGCCTT
CCATTGTGATGCAGCACTATGTGGTCTTATGACCCCTTTTATAAACAATATGATTAGTTTCAAGAAGCCAATTGGAACTGTCACAATTTCTGGTC
ACAAGTTCTTACGATGCCCAGATGCCTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E398554] | SGN-U577168 | Tomato 200607 | Build 2 | 26 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T199880 [Download][View] | Facility Assigned ID: FA0AAD7AA03RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.952 | Expected Error Rate: 0.0116 | Quality Trim Threshold: 14.5 |


