EST details — SGN-E398652

Search information 
Request: 398652Match: SGN-E398652
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184323Clone name: TUS-44-H17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184323 is on microarray TOM1 spot ID 1-1-8.4.16.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C73539 [cLER-5-D19] Trace: SGN-T93052 EST: SGN-E279543 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398652Length: 288 bp (927 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E398652 [] (trimmed) CCGATGATGGGCCATCTTTCAGGCTATGGTACGGGCCATAACGGTACTTCTCATGGGATGCTACCATGTTGATGGCCATGGCTAGAACCCTATCC
CATCATTCCAGGTTTGGTTTCTTAACACTTTTCTTTCTCATAGTAAGATTGTTCATATCCAGGAATGTTGAAGCAATTTGTCGTTGCTGAACCTG
AGATCCAGGATCAAGAGATTGATGAGGAAGTAGAACTTCTCGTGCTTGCCAGTGATGGACTTTGGGATGTTGTACCCCATGAGGATGCTATTTCA
CTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398652] SGN-U563311 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199978 [Download][View] Facility Assigned ID: FA0AAD32CD09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5