EST details — SGN-E398677

Search information 
Request: 398677Match: SGN-E398677
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184460Clone name: TUS-44-N10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184460 is on microarray TOM1 spot ID 1-1-7.2.16.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77160 [cLES-20-C14] Trace: SGN-T102204 EST: SGN-E290525 Direction: 5' Facility: TIGR
Clone: SGN-C184460 [TUS-44-N10] Trace: SGN-T198443 EST: SGN-E397117 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398677Length: 369 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398677 [] (trimmed) GGCTGAAAAATTATTCCCTGAGAAACGTCACAGCTTCGTTCATAATGGCCAGAAGGTGTTCGAATGGGACCAAACGCTTGAAGAATTGAACATTT
ACATAACTCTTCCAGAAAATGTTCCGAAGAAGCTATTTTATTGCAAGGTTGAGTCTAAGCATTTGGAAGTTGGGATCAAAGGCAATCCACCTTAC
CTTAATCATGATCTGATGAACCCAGTGAAGACCGATTGTTCCTTCTGGACTCTAGAGGATGATATACTGCATGTAACCTTACAGAAGAGGGATAA
AGGTCAGACATGGTCTTCTCCTATTTTGGGCCAAGGACAGTTGGATCCATATGCCGGTGATCTTGAACAAATCAGGCTCATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398677] SGN-U580617 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200003 [Download][View] Facility Assigned ID: FA0AAD32DG05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5