EST details — SGN-E398782

Search information 
Request: 398782Match: SGN-E398782
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185033Clone name: TUS-46-F7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185033 is on microarray TOM1 spot ID 1-1-2.2.12.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72205 [cLER-1-H23] Trace: SGN-T92157 EST: SGN-E280603 Direction: 5' Facility: TIGR
Clone: SGN-C185033 [TUS-46-F7] Trace: SGN-T200098 EST: SGN-E398772 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398782Length: 353 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398782 [] (trimmed) AACATGAAATTCGATAAAAGGCATAAATACTTCAATTACAAATCAAGTTTACAAAATATTAGCTACTATGAAATTTTATCCTCTTCTTATACACT
GAGTTTGTCCATTTCCCTTCTTAGTGCATTAGCCCTCACCAAACTTCCAATGGTATTCACAGCAAGCTTCAAGTCTTCAATGGGGTTTCCTGGTG
CAACTTTCTTGTACAAATAGCTGTCGAATGTCATCTTCTGCACATACTCATCAGCGCACATCTCCACGAAAGCTTCTCTTGCTGGATTCGACCTG
TAAAATACCTTCTGCAAGATATCAAGCACCTTGTATGTTGGCCAGTAAGTCTTGTCCCATTTCTCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398782] SGN-U564570 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200108 [Download][View] Facility Assigned ID: FA0AAD34CC04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5