EST details — SGN-E398789

Search information 
Request: 398789Match: SGN-E398789
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183146Clone name: TUS-41-G16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183146 is on microarray TOM1 spot ID 1-1-1.3.3.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C62964 [cLEM-23-K17] Trace: SGN-T87046 EST: SGN-E271518 Direction: 5' Facility: TIGR
Clone: SGN-C183146 [TUS-41-G16] Trace: SGN-T199733 EST: SGN-E398407 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398789Length: 298 bp (944 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398789 [] (trimmed) TTCAAATAATAAATTATTCATTGATTTTATCATAACATCTCAAAACATTAAAATCAGACGAGTAAAGTCTAAAGGTGGACGGAGGTAGTATAGTT
GGAGAGACAACCAAAAAAACAAAGTTAGGTTTGGACTTTTGATATACAAACTTGAGGATTACATTAGGAATAATAATCATCAATTGAAAACATGG
TCAGTCGTCTTATTACTTAATTTTCATGTGTTAAATATCATTAATACTGCATCATACCTCTCTATGACTTTACTCCTAATAACAATTGTATGTAT
CTGCAATGAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398789] SGN-U565691 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200115 [Download][View] Facility Assigned ID: FA0AAD29BD08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5