Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E398942

Search information 
Request: 398942Match: SGN-E398942
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172785Clone name: TUS-14-G23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172785 is on microarray TOM1 spot ID 1-1-2.3.20.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10942 [cLEC-6-L15] Trace: SGN-T24007 EST: SGN-E202346 Direction: 5' Facility: TIGR
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T195123 EST: SGN-E393797 Direction: 3' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T195124 EST: SGN-E393798 Direction: 5' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T195124 EST: SGN-E398943 Direction: 5' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T199541 EST: SGN-E398215 Direction: 5' Facility: INRA
Clone: SGN-C172785 [TUS-14-G23] Trace: SGN-T199611 EST: SGN-E398285 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398942Length: 482 bp (795 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398942 [] (trimmed) AAATACAATAAATTCAGCTTTATTAGTAAAAAGGATACAACGATACAAAAAAATAAAACAGAAAAAAGAATCATTACAAAAACTATAAAATCAAA
TACTATAGCATTACTCTCTAATTCAACAACCTAACTAAGGCAAATGACAAGAAAGTGAGTGGCAAAGTTGCAAGAACCAAAGATGGAGCTGAGGC
ACTTGGTGCTGGTGGTGAATTGACCGGCGAATCGCTCGATGGCACGGTGGGGCTGGATGGTGTAGCCGCGGTGGAAGGCGTGGGGGCGGTCACGT
CCGAACCGGTGACATTGATGGCTAGTTTTTGACCTAATGAACAATGTCTAGGGAATGTACACATATAGAACTGTTCACCAGAATTTGTGAGTCTA
ATTCTGGCTGGACCATTGCTAATTGTGTTTATTGGAGAAGTTGTGTTACATGAGTCATAAGATGCCTTGCTAACCATTTGCAACATTAGGGGGGG
GGAGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398942] SGN-U578433 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199611 [Download][View] Facility Assigned ID: FA0AAD2AD12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5