Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E398963

Search information 
Request: 398963Match: SGN-E398963
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172869Clone name: TUS-14-K11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172869 is on microarray TOM1 spot ID 1-1-6.3.20.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14183 [cLEC-7-C13] Trace: SGN-T25203 EST: SGN-E201921 Direction: 5' Facility: TIGR
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195134 EST: SGN-E393808 Direction: 3' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195317 EST: SGN-E393991 Direction: 5' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195592 EST: SGN-E394266 Direction: 5' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T195592 EST: SGN-E399526 Direction: 5' Facility: INRA
Clone: SGN-C172869 [TUS-14-K11] Trace: SGN-T199612 EST: SGN-E398286 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398963Length: 564 bp (831 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E398963 [] (trimmed) GCTGCCCCCACAAAGAGTGGGTGGCATTGTAACATTGATGAGAAAGAACATGGGAAAAAGTAAGAGCCATAATGGACATAGGCTTGTTGGCCATG
TTTTGGTTCATTGTGTGTTATAGTGAGTAGATATGACTTTTGGATTCTTCCAAGAGGAGCATTTGGTGATAAAAAAATATAAGGTAATGGTACAT
TTTGGATGGGATGGGGTGAATCTTTTTTTGGTTTTGGAAGATGATTTTAAGTTCTTTCTACCATATCCATGATTAACAGAAGAAAGAAGTGAAGA
GAAGAGTTGAATGAACAAAAATGTATATTGCAAATCCTTAACATCATGGTGTTGGTAAATCAAACAATTAAATGAATAATTTCTGGTCCAAGATG
ATACAAAAAAATGCTGAATTTCCTCTATCCAAGTCCAACTCAACTAAACTTGCTTAATGCTGCTTCCCACTATGCTGGGGGGGGGGTGAGCAGCT
TGTGAATCACCAATTTCATCGGTGAGCTGAATGCGATGAATCAAAACATACCACCACTTTTTGCCTACAGGAAAAAGCTTCCGAGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398963] SGN-U594130 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199612 [Download][View] Facility Assigned ID: FA0AAD2AF06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5