Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E399043

Search information 
Request: 399043Match: SGN-E399043
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172726Clone name: TUS-14-E12
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172726 is on microarray TOM1 spot ID 1-1-5.1.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10858 [cLEC-6-H20] Trace: SGN-T24041 EST: SGN-E202380 Direction: 5' Facility: TIGR
Clone: SGN-C172726 [TUS-14-E12] Trace: SGN-T195222 EST: SGN-E393896 Direction: 5' Facility: INRA
Clone: SGN-C172726 [TUS-14-E12] Trace: SGN-T195373 EST: SGN-E394047 Direction: 5' Facility: INRA
Clone: SGN-C172726 [TUS-14-E12] Trace: SGN-T195665 EST: SGN-E394339 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399043Length: 257 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399043 [] (trimmed) ATAGCATTTTCATGGGCAAGGAAACTCTCTCCACCACAGATACAACCGGCGCTACCTTCAAGCTAGTTGGCTTCAATAATTTCATCCGTGCTAAT
CCCCGTTCCGATTTCTTCTCCGTAAAACGCTTCCACCATATCGAATTCTGGTGCGGCGATGCAACCAATACATCTCGTCGTTTCTCTTGGTCTCT
TGGCATGCCGATTACAGCAAAATCTGACCTCTCCACCGGAAATTCTTATCATGCGCCGTATCACCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399043] SGN-U578997 Tomato 200607 Build 2 75 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195222 [Download][View] Facility Assigned ID: FA0AAD2BC06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5