EST details — SGN-E399054

Search information 
Request: 399054Match: SGN-E399054
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172770Clone name: TUS-14-G8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172770 is on microarray TOM1 spot ID 1-1-1.3.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10924 [cLEC-6-K20] Trace: SGN-T24139 EST: SGN-E202478 Direction: 5' Facility: TIGR
Clone: SGN-C172770 [TUS-14-G8] Trace: SGN-T195231 EST: SGN-E393905 Direction: 3' Facility: INRA
Clone: SGN-C172770 [TUS-14-G8] Trace: SGN-T195232 EST: SGN-E393906 Direction: 5' Facility: INRA
Clone: SGN-C172770 [TUS-14-G8] Trace: SGN-T195232 EST: SGN-E399055 Direction: 5' Facility: INRA
Clone: SGN-C172770 [TUS-14-G8] Trace: SGN-T195673 EST: SGN-E394347 Direction: 3' Facility: INRA
Clone: SGN-C172770 [TUS-14-G8] Trace: SGN-T199552 EST: SGN-E398226 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399054Length: 579 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399054 [] (trimmed) GAGGAATAACACAAGTTTATTTATTATTCAGTAGCAAACACACATATTACACATGCAAAACATTATTTCCGTCTTATAAGACGCATAAAATTATT
AGTTTTTCAACGGGCCCTTCTATTGCTATAGTCATAAGCTACGATAGCTTCAACGGACAACTACAAAGGGCCCACCACCCTTATATTTTTCTCCA
ACAAACACAACAAACATATGTTGAAATAAACCATAAAAGGGCTACATATGTTATATTTCTGACCAAGTTCCTTGTATCAAATTATAATTATTTGA
ATTTCTGACAGAACAATTTGCCCTAATTTCACCTTGTGTCCCAGTCAACACATTCAATTGTCCCATCTTGATCATGGAATTCACAAATTCCTTAA
AGAAAAGTGACTCATTGATAGCAAAACTCGTAACAATCCCTCGTGTTCTTCTATCTGTATACAAATCTTGATCCGATGTGAAAAGCCCTTGTCGA
TTCATGAGATCAACGTAGTACTTGTTATCGAACTTGTTAGGTGGATCGTATGTCTAGGACAGTCGTGTTCGTGGAGTTTCTAGTTGGAACATGTT
GTTTTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399054] SGN-U583086 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195673 [Download][View] Facility Assigned ID: FA0AAD2BD04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5