EST details — SGN-E399090

Search information 
Request: 399090Match: SGN-E399090
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172910Clone name: TUS-14-M4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172910 is on microarray TOM1 spot ID 1-1-5.1.20.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172910 [TUS-14-M4] Trace: SGN-T195253 EST: SGN-E393927 Direction: 3' Facility: INRA
Clone: SGN-C172910 [TUS-14-M4] Trace: SGN-T195400 EST: SGN-E394074 Direction: 5' Facility: INRA
Clone: SGN-C172910 [TUS-14-M4] Trace: SGN-T195696 EST: SGN-E394370 Direction: 3' Facility: INRA
Clone: SGN-C172910 [TUS-14-M4] Trace: SGN-T195696 EST: SGN-E399547 Direction: 3' Facility: INRA
Clone: SGN-C172910 [TUS-14-M4] Trace: SGN-T195697 EST: SGN-E394371 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399090Length: 460 bp (855 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399090 [] (trimmed) CCTCTTACCCATACTCCAAATTAATATTAACCCTATCTTTTCTCATATATCCACAAACTCCTTTATTACCTTTGCCAAGATCCTCTATCTTCTTA
ACTTTGACATTGACTCAAAAATATTGTTATACTCATCTTTGTTGAAGAATCAAAGCATGGATCATTTTGGTAATTTAATAAAAGAAGAGTTTGAT
GGATCATTTTTGACGCCTCAACCGAAGGAGTGTCTTCATGAGAATGGACCTCCACCATTTCTTACAAAAACATATGAACTTGTGGATGATCCAAG
TAACAACGACGTCGTTTCTTGGAGTAGAGGTTACAATAGTTTCATAGTATGGGATCCCCAGAATTTGGCCATTAATTTTCTACCAAGGTATTTCA
AGCATAACAATTTCTCAAGCTTTGTCAGGCAGCTCAATACTTATGGATTTAAGAAAGTAAATCCAGACCATTGGGAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399090] SGN-U580800 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195697 [Download][View] Facility Assigned ID: FA0AAD2BG02RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5