Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E399154

Search information 
Request: 399154Match: SGN-E399154
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183527Clone name: TUS-42-G13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183527 is on microarray TOM1 spot ID 1-1-4.3.1.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C2797 [cLEC-17-D8] Trace: SGN-T27217 EST: SGN-E203801 Direction: 5' Facility: TIGR
Clone: SGN-C183527 [TUS-42-G13] Trace: SGN-T1766 EST: SGN-E378314 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183527 [TUS-42-G13] Trace: SGN-T194933 EST: SGN-E393607 Direction: 5' Facility: INRA
Clone: SGN-C183527 [TUS-42-G13] Trace: SGN-T195486 EST: SGN-E394160 Direction: 3' Facility: INRA
Clone: SGN-C183527 [TUS-42-G13] Trace: SGN-T195487 EST: SGN-E394161 Direction: 5' Facility: INRA
Clone: SGN-C183527 [TUS-42-G13] Trace: SGN-T195487 EST: SGN-E399155 Direction: 5' Facility: INRA
Clone: SGN-C183527 [TUS-42-G13] Trace: SGN-T199643 EST: SGN-E398317 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399154Length: 374 bp (895 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399154 [] (trimmed) GATAAATATCGTCATATATATATATATATATAATACATGATGTAGTTTTTACCCAAGTTACCACATATTGAAGTAGTAGTATGTACAAAATTAGG
AAATTGCTCTGTTTTCATATATTGTTATTAGTCTCAAACAATCACACAACTATGTTTGTTTGTGTTGTTACCATCATAACATTTTGCATAGCTAG
AGCATTACTAGTACCCATCGGAATATGGCCGTTATCGTTACTGTTTTTCTCCGTCTTCTTTAATTCTTTCAGTTCTCTCGCCCTCGCTCTCCAGT
TCCAGAAAGTTCCAAACAATGTTTCCATTTCTTCTAGAGTCTTCCCTTGAGTTTCCGGCATCAATGTGTTTAATAACTCCAACACCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399154] SGN-U565600 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199643 [Download][View] Facility Assigned ID: FA0AAD30AD07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5