EST details — SGN-E399165
Search information |
Request: 399165 | Match: SGN-E399165 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C183571 | Clone name: TUS-42-I9 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183571 is on microarray TOM1 spot ID 1-1-8.1.1.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C80072 [cLET-11-C6] | Trace: SGN-T105116 | EST: SGN-E292653 | Direction: 5' | Facility: TIGR |
Clone: SGN-C183571 [TUS-42-I9] | Trace: SGN-T195491 | EST: SGN-E394165 | Direction: 3' | Facility: INRA |
Clone: SGN-C183571 [TUS-42-I9] | Trace: SGN-T200246 | EST: SGN-E399166 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E399165 | Length: 199 bp (974 bp untrimmed) |
Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E399165 [] (trimmed)
GATAAATATCGTCATATATATATATATATATAATACATGATGTAGTTTTTACTCAAGTTACCACATATTGAAGTAGTAGTATGTACAAAATTAGG
AAATTGCTCTGTTTTCATATATTGTTATTAGTCTCAAACAATCACACAACTATGTTTGTTTGTGTTGTTACCAGCAAAACCTTTTGTCTAACTTG
AACCTTGAT
AAATTGCTCTGTTTTCATATATTGTTATTAGTCTCAAACAATCACACAACTATGTTTGTTTGTGTTGTTACCAGCAAAACCTTTTGTCTAACTTG
AACCTTGAT
Unigenes |
Current Unigene builds | |||||
[SGN-E399165] | SGN-U565600 | Tomato 200607 | Build 2 | 65 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T194941 [Download][View] | Facility Assigned ID: FA0AAD30AE05FM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.823 | Expected Error Rate: 0.0062 | Quality Trim Threshold: 14.5 |