EST details — SGN-E399170

Search information 
Request: 399170Match: SGN-E399170
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183579Clone name: TUS-42-I17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183579 is on microarray TOM1 spot ID 1-1-8.1.1.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71776 [cLER-19-B17] Trace: SGN-T96590 EST: SGN-E285018 Direction: 5' Facility: TIGR
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T194942 EST: SGN-E393616 Direction: 3' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T194942 EST: SGN-E399560 Direction: 3' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T194943 EST: SGN-E393617 Direction: 5' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T195492 EST: SGN-E394166 Direction: 3' Facility: INRA
Clone: SGN-C183579 [TUS-42-I17] Trace: SGN-T195959 EST: SGN-E394633 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399170Length: 506 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399170 [] (trimmed) CTCCAGGGGAATTACCAAAATGGTATGCAATAGTGGTTGTGATATTCATTTGTGTATATGTTGCTGGATTCGCTTGGTCATGGGGTCCTCTTGGA
TGGCTCGTACCTAGTGAAATTTTCCCACTGGAAATTCGATCAGCTGCACAAAGTATCAATGTCTCAGTGAACATGATCTTCACATTTGCAGTAGC
ACAAGTTTTCTTAACAATGTTGTGTCATTTGAAGTTTGGATTGTTTCTGTTTTTCGCCTTCTTTGTGGTGATTATGACTGTGTTCATATACTTCT
TCTTGCCTGAGACGAAAAATATTCCGATAGAAGAGATGGTGATTGTGTGGAAAGAACATTGGTTCTGGTCTAAGTTCATGACTGAAGTTGATTAT
CCTGGAACTAGGAATGGAACTGCTGTTGAAATGGCTAAAGGGGGTGCTGGTTACAAAATTGTATGACTTTAGTTTGGGTTTTTAAATTTTTATTT
GTTGTTTGTATAATGTTGTAATGGGGATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399170] SGN-U584262 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195959 [Download][View] Facility Assigned ID: FA0AAD30AE09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5