EST details — SGN-E399258

Search information 
Request: 399258Match: SGN-E399258
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183522Clone name: TUS-42-G8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183522 is on microarray TOM1 spot ID 1-1-1.3.2.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C74979 [cLES-12-F17] Trace: SGN-T100171 EST: SGN-E286640 Direction: 5' Facility: TIGR
Clone: SGN-C183522 [TUS-42-G8] Trace: SGN-T195032 EST: SGN-E393706 Direction: 3' Facility: INRA
Clone: SGN-C183522 [TUS-42-G8] Trace: SGN-T196023 EST: SGN-E394697 Direction: 5' Facility: INRA
Clone: SGN-C183522 [TUS-42-G8] Trace: SGN-T196023 EST: SGN-E399259 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399258Length: 307 bp (1046 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399258 [] (trimmed) ATAATAATTAGAACTTCATACAATACAATATTATTTATTTTACATGCTTTAAGACAAGCCAATATTTTTTAAATTCATCACACAAACAAAGTTAA
TAAATATATATCACGATAGGAACCGATGCATCGAGGTATTTCCGATGAAATTTTCGATCATTTAAATCTTGTGGAGGTGACCCTCTAAATCTCTG
GTAATATCGATCATAAGCTTCAGAAGAGTGACGGGTTCTGGTGTGTCTTCAGTTTTCTTTTCATACACAAATGTCCATGTTGCCCATTTGTCTTC
AAAAGGAGGCGCTAATAAGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399258] SGN-U580909 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200295 [Download][View] Facility Assigned ID: FA0AAD30BD04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5