EST details — SGN-E399260

Search information 
Request: 399260Match: SGN-E399260
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183524Clone name: TUS-42-G10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183524 is on microarray TOM1 spot ID 1-1-7.3.1.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71787 [cLER-19-C13] Trace: SGN-T96383 EST: SGN-E284811 Direction: 5' Facility: TIGR
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T196024 EST: SGN-E394698 Direction: 5' Facility: INRA
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T196024 EST: SGN-E399261 Direction: 5' Facility: INRA
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T199655 EST: SGN-E398329 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399260Length: 367 bp (973 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399260 [] (trimmed) ATAATAATTAGAACTTCATACAATACAATATTATTTATTTTACATGCTTTAAGACAAGCCAATATTTTTTAAATTCATCACACAAACAAAGTTAA
TAAATATATATCACGATAGGAACCGATGCATCGAGGTATTTCCGATGAAATTTTCGATCATTTAAATCTTGTGGAGGTGACCCTCTAAATCTCTG
GTAATATCGATCATAAGCTTCAGAAGAGTGACGGGTTCTGGTGTGTCTTCAGTTTTCTTTTCATACACAAATGTCCATGTTGCCCAATTGTCTTC
AAAAGATGCACTAATAATGAAAGAATTGTACAATTCCAACGTATCTCCCTCTAAAACTTTCCTAGTAATTGATTTTCTTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399260] SGN-U580909 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200296 [Download][View] Facility Assigned ID: FA0AAD30BD05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5