EST details — SGN-E399293

Search information 
Request: 399293Match: SGN-E399293
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183624Clone name: TUS-42-K14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183624 is on microarray TOM1 spot ID 1-1-3.3.1.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C9416 [cLEC-5-N24] Trace: SGN-T23889 EST: SGN-E201054 Direction: 5' Facility: TIGR
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T195049 EST: SGN-E393723 Direction: 5' Facility: INRA
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T196042 EST: SGN-E394716 Direction: 5' Facility: INRA
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T196042 EST: SGN-E399294 Direction: 5' Facility: INRA
Clone: SGN-C183624 [TUS-42-K14] Trace: SGN-T199658 EST: SGN-E398332 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399293Length: 538 bp (943 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399293 [] (trimmed) CAAATTTAACTCATGTTTCCGATATTTAAAATCATAAAATTCAAAAGTCTCCATTTATTTCGTAAACTTGGTGTCTAGTTAACTGATTGACACTG
ATATTTGGTAGAGGAAGTGATACAACAACTTACGATAGTAAATATGACAATTTTAAATTCGTAATAACAACTTAGTTAGTTAATAGCCCTGCAGT
TTGTTCTAATCTCTCCATTAATTCCAGTAAGTGGACTAATATTCCCCATCTTCACCATAGCTGCAGCAAAATCACTTCTAAAACTCGCACCATTG
TTACTATAACTCCTCACCAACGCATCCTGAGATCCACCGTTAAACAATTCCTGATCCGAGTGAAGCAACCCACGCCGAACCACTAGGTTCTGATA
ATAATCATTATCGAACCGGTTCGGAGTCTGGATATCCAACGGGGCCAAATTGGCGTCGCCGCCGGAAGCAGGGCAGGTAGCCCTGCGCGTGGCGG
CGAACTGCGGGTCGATGTTGGTGTCGTTGTAAATTCCGGTTTCTGAAAGTGGTGCACCGAGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399293] SGN-U566251 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200315 [Download][View] Facility Assigned ID: FA0AAD30BF07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5