EST details — SGN-E399328

Search information 
Request: 399328Match: SGN-E399328
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183728Clone name: TUS-42-O22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183728 is on microarray TOM1 spot ID 1-1-3.3.1.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183728 [TUS-42-O22] Trace: SGN-T195065 EST: SGN-E393739 Direction: 3' Facility: INRA
Clone: SGN-C183728 [TUS-42-O22] Trace: SGN-T196059 EST: SGN-E394733 Direction: 5' Facility: INRA
Clone: SGN-C183728 [TUS-42-O22] Trace: SGN-T200466 EST: SGN-E399586 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399328Length: 126 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399328 [] (trimmed) GTGGAGCTAGGTAGGACCTTAGACCTGGCAGAATGTGCTTTGTGGATGCCATGCCAAGGAGGCCTGACTTTTGCACTTTTCCCATATTTTAAACA
TCTAATACCCTCTGGGATCTACTGTGCCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399328] SGN-U590044 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196059 [Download][View] Facility Assigned ID: FA0AAD30BH11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0137 Quality Trim Threshold: 14.5