EST details — SGN-E399352

Search information 
Request: 399352Match: SGN-E399352
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183457Clone name: TUS-42-D15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183457 is on microarray TOM1 spot ID 1-1-2.4.1.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32468 [cLEG-1-M7] Trace: SGN-T64445 EST: SGN-E248382 Direction: 5' Facility: TIGR
Clone: SGN-C183457 [TUS-42-D15] Trace: SGN-T196191 EST: SGN-E394865 Direction: 3' Facility: INRA
Clone: SGN-C183457 [TUS-42-D15] Trace: SGN-T200343 EST: SGN-E399353 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399352Length: 177 bp (1006 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399352 [] (trimmed) AATGGAAAATCTTGCTTCAATTATTGAAATAAGTTTTTTTTCAGAGCAATTGATTTCGCAATTTCTCAGAAATTTTAGAGCATAACTATACTTCT
GTACACAAGATTGGGTTGAAAAATCAAGTCTTCGGCCTCGTTAGGCTTGCCGAAGGGAAGCCGGGCAAGGTGACCACCCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399352] SGN-U587040 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196191 [Download][View] Facility Assigned ID: FA0AAD30CB08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.858 Expected Error Rate: 0.0204 Quality Trim Threshold: 14.5