EST details — SGN-E399385

Search information 
Request: 399385Match: SGN-E399385
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183557Clone name: TUS-42-H19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183557 is on microarray TOM1 spot ID 1-1-6.4.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34358 [cLEG-30-K15] Trace: SGN-T69181 EST: SGN-E255455 Direction: 5' Facility: TIGR
Clone: SGN-C183557 [TUS-42-H19] Trace: SGN-T196090 EST: SGN-E394764 Direction: 3' Facility: INRA
Clone: SGN-C183557 [TUS-42-H19] Trace: SGN-T196091 EST: SGN-E394765 Direction: 5' Facility: INRA
Clone: SGN-C183557 [TUS-42-H19] Trace: SGN-T200364 EST: SGN-E399386 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399385Length: 493 bp (949 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399385 [] (trimmed) ACAAAAGTTCACTAATTTGATAAACATTTGAATGAATGTATATATAAGCTGAACTGCAAAAGCCTACATACACAACAAGCTACACAAAACACTAT
ACTAAAAATCTCATTGTTTTTTTTTACCCCTTTTCTATGCTACATGTTTTTATCAACTTCTTTTAGCTTTACAAATTATTATAGTCTATAAATAC
ATGCTGAAAAATAAAATAAACACCCTAATTGCCTCTATAAATCCTGCGATCGAGCTGATAAAAAATTTGCAGTCCACACAACTAAACGTTTTTCA
GTTCAGTATACCGATGATCTTCAAGCAAAATGTCCTGGATTCGGAAAAAAACAAACAACGTTTGACATTACTGATGCACGGAGGAATCCCTGTAA
TCCATCTTGGCAAAACGTCCCTTGATTCGTGTTCTAGTTTCTGCACAAGCCTTCCTTGACTCGTACCTGAGGTGCTTCCCAAATCCCCGTGGTTT
CATCCCGCACCCCGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399385] SGN-U579017 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196090 [Download][View] Facility Assigned ID: FA0AAD30CD10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0066 Quality Trim Threshold: 12.5