EST details — SGN-E399480
| Search information |
| Request: 399480 | Match: SGN-E399480 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183648 | Clone name: TUS-42-L14 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183648 is on microarray TOM1 spot ID 1-1-3.4.1.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C183648 [TUS-42-L14] | Trace: SGN-T196165 | EST: SGN-E394839 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E399480 | Length: 111 bp (1024 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E399480 [] (trimmed)
CTCGCCATGGTCCACAGGGCCTAACATGAAATTGTGGCAGGATTTGAAGTTGAGCATAATGAATTGGTGGAAGTCAAGGAGCATGCTATCTATAG
TCTAAAGCAGGCAATA
TCTAAAGCAGGCAATA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E399480] | SGN-U585351 | Tomato 200607 | Build 2 | 6 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T196165 [Download][View] | Facility Assigned ID: FA0AAD30DF07RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.928 | Expected Error Rate: 0.0042 | Quality Trim Threshold: 14.5 |


