EST details — SGN-E399519

Search information 
Request: 399519Match: SGN-E399519
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172723Clone name: TUS-14-E9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172723 is on microarray TOM1 spot ID 1-1-8.1.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10854 [cLEC-6-H17] Trace: SGN-T23998 EST: SGN-E202337 Direction: 5' Facility: TIGR
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T195111 EST: SGN-E393785 Direction: 3' Facility: INRA
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T195112 EST: SGN-E393786 Direction: 5' Facility: INRA
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T195743 EST: SGN-E394417 Direction: 3' Facility: INRA
Clone: SGN-C172723 [TUS-14-E9] Trace: SGN-T200172 EST: SGN-E398921 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399519Length: 420 bp (888 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E399519 [] (trimmed) AATCTATTCAAACATTATTTTTATTAAAATAATATGATATATTATAAAACGATATACAATAACTATATATAGCATTCTTTTGATAATATTTTCAA
AGAGTTGCGTTTTTTGACCGTAACAACTATATCCAGATAAGTTATACGTTACCTATTGTATGTGATAATGGGAAAACAATGTTATGTATCGAAAC
ATTATATATATTAAAACGATATATTATGAAATAATATGTAATAACTATCCAGTAAGTCGTCAAACCTTTTTTGGAATCACTTTCAAAGAGTCGCG
TTTTCTAGCTGTTACTCCCATGCTTTCATCCATATTAATAAATTTAGGAGACGGGAGGGAGCTGGAAGCTCCCAATCGAATTCATGAATACAACG
ATCCAAGAGCAAAATGCGTAATTCGAGGGCCAAGAGGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399519] SGN-U591521 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195743 [Download][View] Facility Assigned ID: FA0AAD2AC05FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.910 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5