EST details — SGN-E399541
| Search information |
| Request: 399541 | Match: SGN-E399541 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C172768 | Clone name: TUS-14-G6 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172768 is on microarray TOM1 spot ID 1-1-3.3.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C10917 [cLEC-6-K14] | Trace: SGN-T23970 | EST: SGN-E202309 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C172768 [TUS-14-G6] | Trace: SGN-T195230 | EST: SGN-E393904 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172768 [TUS-14-G6] | Trace: SGN-T195377 | EST: SGN-E394051 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172768 [TUS-14-G6] | Trace: SGN-T195378 | EST: SGN-E394052 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172768 [TUS-14-G6] | Trace: SGN-T195379 | EST: SGN-E394053 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E399541 | Length: 105 bp (982 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E399541 [] (trimmed)
GAAAAGGACAACAGGTCCAACTTCAAGGCTGATTATGGACGCTTCTCAACTAGTGTGGAGGGGGTGTTTGCTGCACGAGACTGTCGTACGGGACC
GTCTTTGATG
GTCTTTGATG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E399541] | SGN-U575484 | Tomato 200607 | Build 2 | 14 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195378 [Download][View] | Facility Assigned ID: FA0AAD2BD03RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.956 | Expected Error Rate: 0.0125 | Quality Trim Threshold: 14.5 |
Working
