EST details — SGN-E399541

Search information 
Request: 399541Match: SGN-E399541
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172768Clone name: TUS-14-G6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172768 is on microarray TOM1 spot ID 1-1-3.3.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10917 [cLEC-6-K14] Trace: SGN-T23970 EST: SGN-E202309 Direction: 5' Facility: TIGR
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195230 EST: SGN-E393904 Direction: 3' Facility: INRA
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195377 EST: SGN-E394051 Direction: 3' Facility: INRA
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195378 EST: SGN-E394052 Direction: 5' Facility: INRA
Clone: SGN-C172768 [TUS-14-G6] Trace: SGN-T195379 EST: SGN-E394053 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399541Length: 105 bp (982 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399541 [] (trimmed) GAAAAGGACAACAGGTCCAACTTCAAGGCTGATTATGGACGCTTCTCAACTAGTGTGGAGGGGGTGTTTGCTGCACGAGACTGTCGTACGGGACC
GTCTTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399541] SGN-U575484 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195378 [Download][View] Facility Assigned ID: FA0AAD2BD03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5