EST details — SGN-E399583

Search information 
Request: 399583Match: SGN-E399583
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183674Clone name: TUS-42-M16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183674 is on microarray TOM1 spot ID 1-1-1.1.1.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183674 [TUS-42-M16] Trace: SGN-T1772 EST: SGN-E378451 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183674 [TUS-42-M16] Trace: SGN-T199425 EST: SGN-E398099 Direction: 3' Facility: INRA
Clone: SGN-C183674 [TUS-42-M16] Trace: SGN-T199659 EST: SGN-E398333 Direction: 5' Facility: INRA
Clone: SGN-C183674 [TUS-42-M16] Trace: SGN-T200323 EST: SGN-E399309 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399583Length: 290 bp (948 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399583 [] (trimmed) TGAAAATGAAGGAACGCGGTATCAGGAAGAAGGTTGTGATGGACTCTGTGTTGATTTTTCACTATTTTCTCCTGTCCAAATAAAAGATGAAGAAG
GGAAACCTCTGCTTTTCTTGGAGTTCTGTAGTTTAGTTTGGAGTCAATTGTTTTGATTCAAAGGTCAATTGCCTGCTAATTTCTGTATACTTGTG
ATTATTGTAATAATAATAATAATAATGTACCAACTTCTATAAATATTTCATTCCCTTACATCTTGAATTCATTAAAGACTGAAGATTTTCATATA
TTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E399583] SGN-U577579 Tomato 200607 Build 2 90 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200463 [Download][View] Facility Assigned ID: FA0AAD30BG08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5