EST details — SGN-E412583

Search information 
Request: 412583Match: SGN-E412583
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268153Clone name: STM-16-D7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268153 [STM-16-D7] Trace: SGN-T264721 EST: SGN-E412584 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E412583Length: 374 bp (957 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E412583 [] (trimmed) ATTTCTTTTACATGATGAGTTGCTCATTGTCTTTTTTATCATATTGTATACTAATTTTAGTGCTTGCATTTTGTGATCTTTCGCTTGAAGTTGAA
AGTCGAGCCTTCTTCGTGTTTGGTGATTCACTAGTAGATAACGGTAACAATAATTACTTACTTACTAGTGCCAGGGCAGATTCTCCCCCCTATGG
CATTGACTACCCTACTCATCGCGCCACTGGTCGATTTTCCAATGGACTCAACATACCCGATATCATAAGTGAGCAATTGGGTATGGAGCCAACAT
TACCATATTTGGCTCCACAACTCACAAGAGATAAGCTTCTTGTTGGAGCAAACTTTGCTTCTGCTGGAGTTGGAATTCTTAATGACACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E412583] SGN-U275473 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T264720 [Download][View] Facility Assigned ID: STMCK16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5