Notice: Due to a wide-spread power outage in the area, SGN was unavailable early on Sunday. We apologize for the inconvenience.

EST details — SGN-E413316

Search information 
Request: 413316Match: SGN-E413316
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C268760Clone name: STM-17-P9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C268760 [STM-17-P9] Trace: SGN-T265454 EST: SGN-E413317 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E413316Length: 409 bp (952 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E413316 [] (trimmed) TTGACGTCCCTATGTATTTTGTCTATCGGAAGAAGAAGTATGTTGATTGTTCTGGATTGTCTTTCCGGGACTTCATGAATGGAAAACTTCCGCCT
ATTCCCGGCGAATATCCTACTCTTAATGATTGGGAGAATCATCTCACAACAATATTTCCTGAGGTCAGACTCAAAAGATATCTGGAAATGAGGGG
TGCTGATGGAGGGCCTTGGAGACGGTTATGTGCATTGCCTGCATTCTGGGTGGGTATACTCTACGATGAGGGGTCTTTGCAAAGTGTTTTAGACA
TGACGTCTGATTGGACTGCGGAAGAAAGAGACATGCTGAGGAATAAGGTGCCAAAAAGTGGTCTGAAGACACCATTTCGAGATGGATTGCTTATG
CATGTTGCTCAAGATGTTGTCAAGTTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E413316] SGN-U271263 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T265453 [Download][View] Facility Assigned ID: STMCO89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5