EST details — SGN-E417501

Search information 
Request: 417501Match: SGN-E417501
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C271144Clone name: STM-25-F13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C271144 [STM-25-F13] Trace: SGN-T269637 EST: SGN-E417500 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E417501Length: 335 bp (810 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E417501 [] (trimmed) TAATATTAAATTTATTCTTCTAGTATATTTTAACGAGTTATAGTGGTATTAAATATATACCAGTAAAACTCTTCAATTAATGTAAAATCTCCCGG
TTACAAACCTGACTCTCATACAAGGGCATCCAAAAGTTGTTCCAAGCCTTCAATGGAGCAATCTCTTGAATGTTCTCAAAATTTTCTTTTACCCT
ACTATTAGCAACTAAACATCTAGCAGAAAATAGCATTAATTCAGTTGAACCCATGTAACCTCTGATCCTCGATACGATTCCACTTTCCCTGGAAA
AGCCCAACCGAAAGTACCTATCCTGACTATTTTCTTCCATCTGCTTCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E417501] SGN-U282453 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T269638 [Download][View] Facility Assigned ID: STMDU31TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5