EST details — SGN-E420902

Search information 
Request: 420902Match: SGN-E420902
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273261Clone name: STM-31-N20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273261 [STM-31-N20] Trace: SGN-T273038 EST: SGN-E420901 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E420902Length: 310 bp (957 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E420902 [] (trimmed) CGAGTTTTTTTCTCCTTTTTTTACATTTTCTGGACAAAAATCCAGTATTTGTTTCCTTTTACATTGACAAGAAAGAAGTATCACACTTGAAAGTC
TTTTGCAGCAACAGAATTGCTGACAAAAAACTGCTATGTTAAACTTCAATCGTTTTCTGATACAGAGAGCTGTATCTCCACCGTTCTTTCTCCAC
AAAGTCTGCATCAAGAAACTGAGCTATGAATGTCCAAAGCCGGTAAACATCTTCAAAGTTGGCCAGAAAGCTAAGGGCAATGGTAACTACTGATA
TCCCAAAGTCAGTTTTTTTAGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E420902] SGN-U295002 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273039 [Download][View] Facility Assigned ID: STMET82TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0018 Quality Trim Threshold: 20.5