EST details — SGN-E422089

Search information 
Request: 422089Match: SGN-E422089
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273992Clone name: STM-34-G11
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273992 [STM-34-G11] Trace: SGN-T274225 EST: SGN-E422088 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422089Length: 239 bp (936 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E422089 [] (trimmed) AAGAATGGCAGGTGTTTTATTTGTCACAACTCACAAAGGACTTGTCACCTTGATAGAAAAAATAGCATTCTAATATTTCTTAATTGAGAACGTAA
ACAGCATTTTGTGAAAGTAGGGATTTTCCGGAGTCACAATTGTTGATGGGAAATTTGGGTGATTCACAGCATCAGGGAATCCTTGAGTCTCCAAA
CAGATGGCTGAATAAGGCTGATTATCAAATCCACCTTTCCCCTTCTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422089] SGN-U276520 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274226 [Download][View] Facility Assigned ID: STMFC42TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0106 Quality Trim Threshold: 20.5