Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E422131

Search information 
Request: 422131Match: SGN-E422131
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274037Clone name: STM-40-A5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274037 [STM-40-A5] Trace: SGN-T274269 EST: SGN-E422132 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422131Length: 331 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E422131 [] (trimmed) CTAATTCACAAACGTTTGGGACGTCCGAGTCTATCCAAGCTATAGAAGATGGTGCCTAGTTTGTCTAGTTTATCCACATTAGATTGTGAGTCGTG
TTAACTTGGGAAACACACCATGCCACATTTTCACGTAGTACTGATGGGCTTTCAAAGTCTATTTTTTCATTAGTTCATTCTGACATTTGGGGTTC
TAGTAGAGTCATTTCAACCTTAGGATGTCGTTATTTCTTTAGTTTCATTGATGATTGTTCAAGATGCACGTGAGTTTTCTTAATGAAAGATCNGT
CTGAAGTATTTTGTATATTCTAAAAGTTCTTTGCTGAAAATCAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422131] SGN-U268595 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274268 [Download][View] Facility Assigned ID: STMGA03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5