EST details — SGN-C46352
| Search information |
| Request: 46352 | Match: SGN-C46352 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C46352 | Clone name: cLEI-12-E15 |
| ||
| Library Name: cLEI | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: whole seedlings
Development Stage: germinating seed
Microarray: Alias clone SGN-C185254 is on microarray TOM1: SGN-S1-1-5.3.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E267661 | Length: 243 bp (900 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E267661 [] (trimmed)
TGGGGAAGCCATTAAATCAAATGGCGACGGAGCTAGAAGAATTGATTGGGTTTCTATCATCCCCTTCTCCTCCAGTGAAAAAAATAGCGGCTGAT
ATCGCTCGAGATTATACTGGTTCTGAGGATGGCTTGGAATCTCTTGGCAAGTATTCTAACGTCGTGCTTCCTTCTCTGTCTCGCCTTCTTGGTGA
AAAAAAGGTGGTTTCTGAACCTGCGGCTCAAGCACTGGTCAATCTGTCACAAA
ATCGCTCGAGATTATACTGGTTCTGAGGATGGCTTGGAATCTCTTGGCAAGTATTCTAACGTCGTGCTTCCTTCTCTGTCTCGCCTTCTTGGTGA
AAAAAAGGTGGTTTCTGAACCTGCGGCTCAAGCACTGGTCAATCTGTCACAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E267661] | SGN-U582573 | Tomato 200607 | Build 2 | 19 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T82080 [Download][View] | Facility Assigned ID: TGSBS32TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.968 | Expected Error Rate: 0.0203 | Quality Trim Threshold: 14.5 |
Working
