EST details — SGN-E514734

Search information 
Request: 514734Match: SGN-E514734
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308475Clone name: cSML-11-H5
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308475 [cSML-11-H5] Trace: SGN-T315606 EST: SGN-E514733 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514734Length: 297 bp (639 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E514734 [] (trimmed) CTGCTTTGCATGACAATACATGAACTCCATGTAAACATTAACTCCAGAACCTCAGCTCCGCCTAAATGGCTCCACAAAAAAATTCAAAGAATGTC
CTAAGATTCTAATTAGTGAAACTTATATCCTTTCACTGAGATCTTCTTCTTATATGTTGAGAAACTTGGTACCCCTCGAAGAAATCCAAGACAGC
AGTCTCAATGTCCTCACCAGAATACTTGATATAATTGTCTGGATGCCTCCCACTCTCAATATGACTCCTAAACCTTCCGAGAAATGATCTATAAG
CTGGGATCAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514734] SGN-U206493 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T315607 [Download][View] Facility Assigned ID: cC-smflcSML11H5d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0081 Quality Trim Threshold: 20.5