EST details — SGN-E515169

Search information 
Request: 515169Match: SGN-E515169
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308717Clone name: cSML-12-D7
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308717 [cSML-12-D7] Trace: SGN-T316043 EST: SGN-E515170 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515169Length: 206 bp (1129 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E515169 [] (trimmed) CAGTCCGGTGCACTCTCAGCGTCGAGTCTCCGTCGTCGTCCGCCACCGACCGAGGTGATGACTCGCCCAAGGTTTTACTTGAAGTTAGGGACCTC
TCCGCTGTCATTGCCGAGTCAAAGCAGCAAATTCTCAATGGCGTTAACCTCACTGTCCGCCAAGGCGAGGTACATGCTGTAATGGGTAAGAACGG
TTCTGGAAAGAGCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515169] SGN-U207383 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T316042 [Download][View] Facility Assigned ID: cC-smflcSML12D7c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0071 Quality Trim Threshold: 20.5