EST details — SGN-E516608

Search information 
Request: 516608Match: SGN-E516608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C309497Clone name: cSML-14-K18
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C309497 [cSML-14-K18] Trace: SGN-T317482 EST: SGN-E516609 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E516608Length: 357 bp (640 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E516608 [] (trimmed) AAAAATTCATTTAAGCATAAAAGACACCATTAAAATACAAAATAGTAGTGATGTGTCTTAAGAGCAGCAATAGAATAAAACACCCAAACGAAAAT
ACAATCCAACAAACAAAGCCATCATGTGTTTTAATATTCCTCGTGATCTTCATCTTCTCCATCGTCAACTTCAGCACCAACCTCCTCGTAATCCT
TCTCCAGAGCAGCCAGATCTTCACGTGCTTCACTGAATTCACCTTCCTCCATACCCTCACCAACATACCAGTGCACAAAAGCACGCTTGGCATAC
ATCAGATCAAACTTGTGATCAATGCGTGAGAAGACCTTAGCAACACTGGTTGAATTGGATATCATACACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E516608] SGN-U205598 Solanum melongena Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T317481 [Download][View] Facility Assigned ID: cC-smflcSML14K18c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0048 Quality Trim Threshold: 20.5