EST details — SGN-E526416
| Search information |
| Request: 526416 | Match: SGN-E526416 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C326257 | Clone name: Petunia-C2H4-7-D08 |
| ||
| Library Name: Petunia-C2H4 | Organism: Petunia hybrida |
Tissue: all floral organs
Development Stage: anthesis
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C326257 [Petunia-C2H4-7-D08] | Trace: SGN-T334187 | EST: SGN-E526512 | Direction: Unknown | Facility: U Fla ICBR |
| Sequence |
| Sequence Id: SGN-E526416 | Length: 192 bp (895 bp untrimmed) |
| Status: Current Version | Direction: Unknown |
>SGN-E526416 [] (trimmed)
AATTTATATAATTGCTTCTACTATACTTTCGTCAAGACCCTAATGAACCAATAATAAATAGGACTATCTTTTCTGATTTCATTGATCTGTTCCTC
CTGTTGAAATATGGTCTTATCAACACATGCATGTATTCCCATTAGTATAATCAAAATGCTTAAGAAGTACGTAAAAAAAAAAAAAAAAAAAAAAA
AA
CTGTTGAAATATGGTCTTATCAACACATGCATGTATTCCCATTAGTATAATCAAAATGCTTAAGAAGTACGTAAAAAAAAAAAAAAAAAAAAAAA
AA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E526416] | SGN-U208151 | Petunia hybrida | Build 1 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T333707 [Download][View] | Facility Assigned ID: Petunia-C2H4-7-D08.g |
| Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.895 | Expected Error Rate: 0.0019 | Quality Trim Threshold: 12.5 |


