EST details — SGN-E526416

Search information 
Request: 526416Match: SGN-E526416
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326257Clone name: Petunia-C2H4-7-D08
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C326257 [Petunia-C2H4-7-D08] Trace: SGN-T334187 EST: SGN-E526512 Direction: Unknown Facility: U Fla ICBR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526416Length: 192 bp (895 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526416 [] (trimmed) AATTTATATAATTGCTTCTACTATACTTTCGTCAAGACCCTAATGAACCAATAATAAATAGGACTATCTTTTCTGATTTCATTGATCTGTTCCTC
CTGTTGAAATATGGTCTTATCAACACATGCATGTATTCCCATTAGTATAATCAAAATGCTTAAGAAGTACGTAAAAAAAAAAAAAAAAAAAAAAA
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526416] SGN-U208151 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T333707 [Download][View] Facility Assigned ID: Petunia-C2H4-7-D08.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.895 Expected Error Rate: 0.0019 Quality Trim Threshold: 12.5