EST details — SGN-E537903

Search information 
Request: 537903Match: SGN-E537903
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189034Clone name: TUS-56-L24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C45988 [cLEI-10-F21] Trace: SGN-T81781 EST: SGN-E264942 Direction: 5' Facility: TIGR
Clone: SGN-C189034 [TUS-56-L24] Trace: SGN-T338781 EST: SGN-E537906 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537903Length: 248 bp (891 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E537903 [] (trimmed) TTATTCGACATTTTTTTCTCAAATTTCAGAGCTTTTCAGTTCGCCGTGTCTAAAAAAAATTCATGGAGAAAACTGAAAGTTCCAAAATTGTAAGA
ATTTAGGAGCGAATAGGAAAGATTTAATAGTCATATAAGGCTACCGTAAACCTAATTGGAGACTGGGGAGAATCCCAACTAGATACTATGAATTA
TAAGAGGCAATTCTCCCGAATAAGGGTCGGATCGGTTACTCCTGTGGGAGCAACCGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537903] SGN-U592345 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338778 [Download][View] Facility Assigned ID: TUS56L24_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.570 Expected Error Rate: 0.0078 Quality Trim Threshold: 20.5