EST details — SGN-E537923

Search information 
Request: 537923Match: SGN-E537923
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189044Clone name: TUS-56-M10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46057 [cLEI-11-B14] Trace: SGN-T82041 EST: SGN-E265886 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E537923Length: 113 bp (941 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E537923 [] (trimmed) TGGTGAGGACTGGAGGGAAGAATCTATAACCGGCGGATCACTTAAGCATGTGGATTTGGACAAGGGTAAAAACGGTTGGGCATCACCACCGGGAG
ACCTATTCAATCTGCGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E537923] SGN-U565938 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338798 [Download][View] Facility Assigned ID: TUS56M10_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0536 Quality Trim Threshold: 14.5