EST details — SGN-E537923
| Search information |
| Request: 537923 | Match: SGN-E537923 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C189044 | Clone name: TUS-56-M10 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C46057 [cLEI-11-B14] | Trace: SGN-T82041 | EST: SGN-E265886 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E537923 | Length: 113 bp (941 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E537923 [] (trimmed)
TGGTGAGGACTGGAGGGAAGAATCTATAACCGGCGGATCACTTAAGCATGTGGATTTGGACAAGGGTAAAAACGGTTGGGCATCACCACCGGGAG
ACCTATTCAATCTGCGAG
ACCTATTCAATCTGCGAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E537923] | SGN-U565938 | Tomato 200607 | Build 2 | 14 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T338798 [Download][View] | Facility Assigned ID: TUS56M10_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.974 | Expected Error Rate: 0.0536 | Quality Trim Threshold: 14.5 |
Working
